You are viewing the site in preview mode

Skip to main content
Figure 1 | Genetic Vaccines and Therapy

Figure 1

From: Anti-metastatic effects of viral and non-viral mediated Nk4 delivery to tumours

Figure 1

Vector Constructs. pSelectBlasti-MCS and pSelectBlasti-2BhIL32b were purchased from Invivogen (Cayla SAS, Toulouse, France). Coding sequences (IL32 and Bsr = Blasticidin resistance gene) are indicated in dark outline. The functionality of the human IL32b sequence in mice has previously been published [16]. The CMV and hEF1/HTLV composite promoters are indicated in grey. For AAV vector constructs, the IL32 (Nk4) expression cassette including the blasticidin resistance gene was PCR amplified using primers designed with a XhoI and HindIII restriction site overhang, (forward-hindIII: 5'AGCAGCAGCTTCCCTGCTTGCTCAACTCTAC3', reverse-xhoI: 5'AGCAGCCTCGAGCAGGCGTTACATAACTTACGG3'and cloned into pAAV-MCS. Clone sequences were validated by sequencing (MWG Biotech).

Back to article page